- Correction
- Open access
- Published:
Correction: Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation
Molecular Cancer volume 22, Article number: 50 (2023)
Correction: Mol Cancer 20, 88 (2021)
https://0-doi-org.brum.beds.ac.uk/10.1186/s12943-021-01384-w
Following publication of the original article [1], the authors would like to correct the sequence information for two RT-qPCR primers (MMP1 forward; LCK forward) listed in Table 1.
The primer sequences (5’ > 3’) currently read:
MMP1 forward: TGTGAGGCGGTAGTAGGACA
LCK forward: GACAGCATTCACCAGGACCA
The primer sequences (5’ > 3’) should read:
MMP1 forward: CACGCCAGATTTGCCAAGAG
LCK forward: GATGGGGTACTACAACGGGC
The correction does not have any effect on the results or conclusions of the article. The authors would like to apologize for these errors and any confusion that these might have caused.
Reference
Weiße J, Rosemann J, Müller L, et al. Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation. Mol Cancer. 2021;20:88. https://0-doi-org.brum.beds.ac.uk/10.1186/s12943-021-01384-w.
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Weiße, J., Rosemann, J., Müller, L. et al. Correction: Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation. Mol Cancer 22, 50 (2023). https://0-doi-org.brum.beds.ac.uk/10.1186/s12943-023-01758-2
Published:
DOI: https://0-doi-org.brum.beds.ac.uk/10.1186/s12943-023-01758-2